reverse-complement
CommunityCompute reverse complements and strand-aware operations on DNA/RNA sequences.
Authorpradyumnasagar
Version1.0.0
Installs0
System Documentation
What problem does it solve?
This Skill computes reverse complements, complements, and strand-aware operations on DNA/RNA sequences, providing support for IUPAC ambiguity, batch processing, and orientation handling.
Core Features & Use Cases
- Reverse Complement Calculation: Compute reverse complements for DNA/RNA sequences.
- Complement Calculation: Compute complements for DNA/RNA sequences.
- Strand-Aware Operations: Perform strand-aware operations such as translating minus-strand genes and converting feature coordinates between strands.
- Batch Processing: Process multiple sequences in batch mode.
- Use Case: Design primers and probes for DNA/RNA, translate minus-strand genes, or convert feature coordinates from one strand to another.
Quick Start
Use the reverse-complement skill to compute the reverse complement of the sequence 'ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG'.
Dependency Matrix
Required Modules
biopython
Components
scripts
💻 Claude Code Installation
Recommended: Let Claude install automatically. Simply copy and paste the text below to Claude Code.
Please help me install this Skill: Name: reverse-complement Download link: https://github.com/pradyumnasagar/open-research-skills/archive/main.zip#reverse-complement Please download this .zip file, extract it, and install it in the .claude/skills/ directory.
Agent Skills Search Helper
Install a tiny helper to your Agent, search and equip skill from 620,000+ vetted skills library on demand.