reverse-complement

Compute reverse complements and complements for DNA/RNA sequences with IUPAC ambiguity support.

6|2|Updated Jun 11, 2026
One-click install
npx skills add https://github.com/pradyumnasagar/open-research-skills --skill reverse-complement
Or copy as Structured Prompt for Agent
Please help me install this Agent Skill.
Skill: reverse-complement
Source: https://github.com/pradyumnasagar/open-research-skills/tree/main/skills/bioinformatics-sequence/reverse-complement
Command: npx skills add https://github.com/pradyumnasagar/open-research-skills --skill reverse-complement

SYSTEM DOCUMENTATION & REQUIREMENTS

💡 This Skill requires biopython, and includes scripts (resource) components.

What problem does it solve?

This Skill computes reverse complements, complements, and strand-aware operations on DNA/RNA sequences, providing support for IUPAC ambiguity, batch processing, and orientation handling.

Core Features & Use Cases

  • Reverse Complement Calculation: Compute reverse complements for DNA/RNA sequences.
  • Complement Calculation: Compute complements for DNA/RNA sequences.
  • Strand-Aware Operations: Perform strand-aware operations such as translating minus-strand genes and converting feature coordinates between strands.
  • Batch Processing: Process multiple sequences in batch mode.
  • Use Case: Design primers and probes for DNA/RNA, translate minus-strand genes, or convert feature coordinates from one strand to another.

Quick Start

Use the reverse-complement skill to compute the reverse complement of the sequence 'ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG'.

Frequently Asked Questions about reverse-complement

High-intent search queries and answers about installing and using this skill.

FAQPage Schema
How do I compute the reverse complement of a DNA sequence?

To compute the reverse complement of a DNA sequence, you reverse the nucleotide order and swap each base with its complement. This Skill supports DNA/RNA sequences, IUPAC ambiguity codes, and batch processing for efficient sequence manipulation.

What is strand-aware sequence manipulation in bioinformatics?

Strand-aware sequence manipulation involves handling DNA/RNA orientation for tasks like translating minus-strand genes or converting feature coordinates between strands. This Skill performs these operations while correctly computing complements and reverse complements.

Can I process multiple DNA or RNA sequences in batch mode?

Yes, you can process multiple DNA or RNA sequences in batch mode. This Skill supports batch processing, allowing you to compute reverse complements and complements for numerous sequences simultaneously, which is ideal for high-throughput primer or probe design.

Does this reverse complement tool support IUPAC ambiguity codes?

Yes, this reverse complement tool supports IUPAC ambiguity codes. It correctly handles ambiguous nucleotides during complement and reverse complement calculations, ensuring accurate sequence manipulation for complex bioinformatics workflows.

Do I need Biopython to calculate reverse complements and strand-aware operations?

Yes, you need Biopython installed to calculate reverse complements and perform strand-aware operations. This Skill requires the Biopython library to handle its underlying sequence operations and IUPAC ambiguity support.

What is the best way to design primers and probes using DNA or RNA sequences?

The best way to design primers and probes is by using strand-aware sequence manipulation to compute accurate reverse complements. This Skill handles orientation and IUPAC ambiguity, ensuring correct primer and probe sequences for your bioinformatics targets.

Related Skills