reverse-complement

Community

Compute reverse complements and strand-aware operations on DNA/RNA sequences.

Authorpradyumnasagar
Version1.0.0
Installs0

System Documentation

What problem does it solve?

This Skill computes reverse complements, complements, and strand-aware operations on DNA/RNA sequences, providing support for IUPAC ambiguity, batch processing, and orientation handling.

Core Features & Use Cases

  • Reverse Complement Calculation: Compute reverse complements for DNA/RNA sequences.
  • Complement Calculation: Compute complements for DNA/RNA sequences.
  • Strand-Aware Operations: Perform strand-aware operations such as translating minus-strand genes and converting feature coordinates between strands.
  • Batch Processing: Process multiple sequences in batch mode.
  • Use Case: Design primers and probes for DNA/RNA, translate minus-strand genes, or convert feature coordinates from one strand to another.

Quick Start

Use the reverse-complement skill to compute the reverse complement of the sequence 'ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG'.

Dependency Matrix

Required Modules

biopython

Components

scripts

💻 Claude Code Installation

Recommended: Let Claude install automatically. Simply copy and paste the text below to Claude Code.

Please help me install this Skill:
Name: reverse-complement
Download link: https://github.com/pradyumnasagar/open-research-skills/archive/main.zip#reverse-complement

Please download this .zip file, extract it, and install it in the .claude/skills/ directory.
View Source Repository

Agent Skills Search Helper

Install a tiny helper to your Agent, search and equip skill from 620,000+ vetted skills library on demand.