sequence

Translate DNA sequences, detect ORFs, and check primers locally.

475|61|Updated May 28, 2026
One-click install
npx skills add https://github.com/exon-research/genomi --skill sequence-exon-research
Or copy as Structured Prompt for Agent
Please help me install this Agent Skill.
Skill: sequence
Source: https://github.com/exon-research/genomi/tree/main/skills/sequence
Command: npx skills add https://github.com/exon-research/genomi --skill sequence-exon-research

SYSTEM DOCUMENTATION & REQUIREMENTS

💡 This Skill includes scripts (resource) components.

What problem does it solve?

This Skill simplifies the analysis of DNA sequences by providing deterministic utilities for translation, ORF discovery, restriction site mapping, and more, without the need for external services.

Core Features & Use Cases

  • Sequence Analysis: Offers a suite of tools for sequence translation, ORF detection, primer checking, and more.
  • ORF Discovery: Identifies open reading frames in DNA sequences.
  • Primer Checking: Validates primer properties and template amplicons.
  • Use Case: A researcher can use this Skill to quickly translate a DNA sequence, find ORFs, and check primer sequences for a specific experiment.

Quick Start

Analyze the DNA sequence 'ATGGCCATTGTAATGGGCCGCTGA' using the sequence tools.

Frequently Asked Questions about sequence

High-intent search queries and answers about installing and using this skill.

FAQPage Schema
How do I find open reading frames in a DNA sequence?

ORF detection identifies open reading frames in DNA sequences by scanning your supplied sequence locally. It operates deterministically without external annotation, allowing you to quickly discover potential coding regions.

Can I check primer sequences and template amplicons locally?

Yes, primer checking validates primer properties and template amplicons locally. You can verify your primer sequences against supplied templates to ensure accurate amplification without relying on external services.

What is the best way to translate a DNA sequence to protein?

Sequence translation converts your supplied DNA sequences into protein sequences deterministically. It provides precise translation tools locally, ensuring accurate results without needing external annotation services.

Does this DNA analysis tool work without external annotation services?

Yes, this DNA analysis operates entirely on user-supplied sequences and local references without external annotation. It provides deterministic sequence analysis tools for translation, ORF detection, and primer checking offline.

How do I perform local FASTA matching against my DNA sequences?

Local FASTA matching aligns your query DNA sequences against local references. This feature allows you to find matching regions locally and deterministically, without sending your data to external services.

Can I map restriction sites in a DNA sequence locally?

Restriction site mapping identifies specific enzyme cut sites within your supplied DNA sequences. It functions as part of a deterministic local sequence analysis suite, requiring no external services.