sequence-properties
CommunityCalculate key sequence properties for DNA, RNA, and protein sequences.
Authorpradyumnasagar
Version1.0.0
Installs0
System Documentation
What problem does it solve?
This Skill allows users to easily compute various properties of DNA, RNA, and protein sequences, including GC content, molecular weight, melting temperature, isoelectric point, and instability index, among others.
Core Features & Use Cases
- Sequence Properties Calculation: Compute key properties for sequences like GC content, molecular weight, melting temperature, isoelectric point, and instability index.
- Use Case: When designing primers or proteins, it is essential to understand these properties to optimize performance. This Skill helps with this.
Quick Start
Run the sequence-properties skill on your DNA sequence 'ATGCATGCATGCATGCATGC' to calculate its GC content and molecular weight.
Dependency Matrix
Required Modules
biopython
Components
scriptsreferences
💻 Claude Code Installation
Recommended: Let Claude install automatically. Simply copy and paste the text below to Claude Code.
Please help me install this Skill: Name: sequence-properties Download link: https://github.com/pradyumnasagar/open-research-skills/archive/main.zip#sequence-properties Please download this .zip file, extract it, and install it in the .claude/skills/ directory.
Agent Skills Search Helper
Install a tiny helper to your Agent, search and equip skill from 620,000+ vetted skills library on demand.