sequence-properties

Compute GC content, molecular weight, and melting temperature for DNA, RNA, and protein sequences.

6|2|Updated Jun 11, 2026
One-click install
npx skills add https://github.com/pradyumnasagar/open-research-skills --skill sequence-properties
Or copy as Structured Prompt for Agent
Please help me install this Agent Skill.
Skill: sequence-properties
Source: https://github.com/pradyumnasagar/open-research-skills/tree/main/skills/bioinformatics-sequence/sequence-properties
Command: npx skills add https://github.com/pradyumnasagar/open-research-skills --skill sequence-properties

SYSTEM DOCUMENTATION & REQUIREMENTS

💡 This Skill requires biopython, and includes scripts (resource) and references (resource) components.

What problem does it solve?

This Skill allows users to easily compute various properties of DNA, RNA, and protein sequences, including GC content, molecular weight, melting temperature, isoelectric point, and instability index, among others.

Core Features & Use Cases

  • Sequence Properties Calculation: Compute key properties for sequences like GC content, molecular weight, melting temperature, isoelectric point, and instability index.
  • Use Case: When designing primers or proteins, it is essential to understand these properties to optimize performance. This Skill helps with this.

Quick Start

Run the sequence-properties skill on your DNA sequence 'ATGCATGCATGCATGCATGC' to calculate its GC content and molecular weight.

Frequently Asked Questions about sequence-properties

High-intent search queries and answers about installing and using this skill.

FAQPage Schema
How do I calculate GC content and molecular weight for a DNA sequence?

Calculating GC content and molecular weight for a DNA sequence involves processing the raw nucleotide string to determine its composition and mass. The tool computes these sequence properties to support primer design and genome composition analysis.

Can I compute the melting temperature and isoelectric point of protein sequences?

Yes, you can compute the melting temperature and isoelectric point for protein sequences. The tool evaluates these molecular properties to aid in protein characterization and optimization tasks.

Do I need Biopython to analyze sequence properties like instability index?

Yes, you need Biopython installed to calculate the instability index and other sequence properties. The tool relies on Biopython and its associated utilities to perform the underlying sequence-based calculations.

What is the best way to calculate nucleic acid properties for primer design?

The best way to calculate nucleic acid properties for primer design is to analyze the sequence for GC content and melting temperature. This helps optimize primer performance by ensuring the calculated properties meet experimental constraints.

How does sequence analysis handle RNA sequences for molecular weight calculation?

Sequence analysis handles RNA sequences by computing their specific molecular weight alongside other properties. This supports bioinformatics research by providing accurate molecular data for RNA probe design and characterization.

Related Skills