sequence-properties

Community

Calculate key sequence properties for DNA, RNA, and protein sequences.

Authorpradyumnasagar
Version1.0.0
Installs0

System Documentation

What problem does it solve?

This Skill allows users to easily compute various properties of DNA, RNA, and protein sequences, including GC content, molecular weight, melting temperature, isoelectric point, and instability index, among others.

Core Features & Use Cases

  • Sequence Properties Calculation: Compute key properties for sequences like GC content, molecular weight, melting temperature, isoelectric point, and instability index.
  • Use Case: When designing primers or proteins, it is essential to understand these properties to optimize performance. This Skill helps with this.

Quick Start

Run the sequence-properties skill on your DNA sequence 'ATGCATGCATGCATGCATGC' to calculate its GC content and molecular weight.

Dependency Matrix

Required Modules

biopython

Components

scriptsreferences

💻 Claude Code Installation

Recommended: Let Claude install automatically. Simply copy and paste the text below to Claude Code.

Please help me install this Skill:
Name: sequence-properties
Download link: https://github.com/pradyumnasagar/open-research-skills/archive/main.zip#sequence-properties

Please download this .zip file, extract it, and install it in the .claude/skills/ directory.
View Source Repository

Agent Skills Search Helper

Install a tiny helper to your Agent, search and equip skill from 620,000+ vetted skills library on demand.